Review



hela wild type wt cells  (CLS Cell Lines Service GmbH)


Bioz Verified Symbol CLS Cell Lines Service GmbH is a verified supplier
Bioz Manufacturer Symbol CLS Cell Lines Service GmbH manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    CLS Cell Lines Service GmbH hela wild type wt cells
    Hela Wild Type Wt Cells, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 95/100, based on 120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+wild+type+wt+cells/HeLa+Cells/pm38971996-70-0-7
    Average 95 stars, based on 120 article reviews
    hela wild type wt cells - by Bioz Stars, 2026-11
    95/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: SARS-CoV-2 Spike Protein Induces Time-Dependent CTSL Upregulation in HeLa Cells and Alveolarspheres.
    Article Snippet: HeLa CTSL knockout (KO) cells were generated using recombinant SpCas9 2NLS nuclease and sgRNA against CTSL, 5′‐GAUGAUUGAACUGCACAAUC‐3′ (Synthego). .. HeLa wild‐ type (WT) cells (obtained from CLS Cell Lines Service) were electroplated using the Neon Transfection System (Thermo Fisher Scientific; #MPK5000), and the obtained HeLa CTSL mixed clone was cultivated for an additional 2 days before being split into single clones through serial dilution. .. HeLa CTSL KO clones were verified via inference of CRISPR Edits analysis (https://ice.synthego.com/#/) of the targeted gene region and immunoblotting against CTSL (1:1000; R&D Systems; #AF952).

    Clone Assay:

    Article Title: SARS-CoV-2 Spike Protein Induces Time-Dependent CTSL Upregulation in HeLa Cells and Alveolarspheres.
    Article Snippet: HeLa CTSL knockout (KO) cells were generated using recombinant SpCas9 2NLS nuclease and sgRNA against CTSL, 5′‐GAUGAUUGAACUGCACAAUC‐3′ (Synthego). .. HeLa wild‐ type (WT) cells (obtained from CLS Cell Lines Service) were electroplated using the Neon Transfection System (Thermo Fisher Scientific; #MPK5000), and the obtained HeLa CTSL mixed clone was cultivated for an additional 2 days before being split into single clones through serial dilution. .. HeLa CTSL KO clones were verified via inference of CRISPR Edits analysis (https://ice.synthego.com/#/) of the targeted gene region and immunoblotting against CTSL (1:1000; R&D Systems; #AF952).

    Serial Dilution:

    Article Title: SARS-CoV-2 Spike Protein Induces Time-Dependent CTSL Upregulation in HeLa Cells and Alveolarspheres.
    Article Snippet: HeLa CTSL knockout (KO) cells were generated using recombinant SpCas9 2NLS nuclease and sgRNA against CTSL, 5′‐GAUGAUUGAACUGCACAAUC‐3′ (Synthego). .. HeLa wild‐ type (WT) cells (obtained from CLS Cell Lines Service) were electroplated using the Neon Transfection System (Thermo Fisher Scientific; #MPK5000), and the obtained HeLa CTSL mixed clone was cultivated for an additional 2 days before being split into single clones through serial dilution. .. HeLa CTSL KO clones were verified via inference of CRISPR Edits analysis (https://ice.synthego.com/#/) of the targeted gene region and immunoblotting against CTSL (1:1000; R&D Systems; #AF952).



    Similar Products

    wild type wt hela cells  (ATCC)
    99
    ATCC wild type wt hela cells
    Wild Type Wt Hela Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+wild+type+wt+cells/HeLa/pm39827287-457-12-16
    Average 99 stars, based on 1 article reviews
    wild type wt hela cells - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    hela wild type wt cells  (ATCC)
    99
    ATCC hela wild type wt cells
    INTS6 is required for efficient DNA damage repair. ( A ) Left: Representative images of the clonogenic assay in control and INTS6 knockdown cells. The cells were stained and counted after 10 days of growing. Right: Quantification of left. * P ≤ 0.05, ** P ≤ 0.01. ( B ) MTT assay to show cell viability (%) at indicated time points in siCtrl and siINTS6 cells with or without 2 Gy IR treatment. Error bar = mean ± SD, significance was determined using unpaired Student’s t -test, * P ≤ 0.05. ( C ) Left: Drawing of DR-GFP HR reporter strategy. Right: Bar chart shows the efficiency of HR repair in DR-GFP <t>HeLa</t> reporter cells, as measured by FACS. BRCA1 knockdown was used as the positive control. ****P ≤ 0.0001, ***P ≤ 0.001. ( D ) Top: Representative images of comet assay in siCtrl, siINTS6, siRAD51 and si53BP1 cells. siRAD51 and si53BP1 cells were used as positive controls. IR = 5 Gy. Error bar = 100 μm. Bottom: Quantification of top. **** P ≤ 0.0001, ** P ≤ 0.01. ( E ) Model: INTS6 as part of tetrameric SOSS1 complex binds to DNA:RNA hybrids at DSBs and recruits PP2A to dephosphorylate RNAPII. Depletion of INTS6 results in increased levels of DARTs and DNA:RNA hybrids. INTS6 interacts with SETX and is required for its recruitment to damaged sites. SETX, in turn, resolves DNA:RNA hybrids at DSBs facilitating their INTS6-dependent autoregulation. Image was created with Biorender.
    Hela Wild Type Wt Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+wild+type+wt+cells/HeLa/pmc11602137-90-0-7
    Average 99 stars, based on 1 article reviews
    hela wild type wt cells - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    hela wild type wt cells  (CLS Cell Lines Service GmbH)
    95
    CLS Cell Lines Service GmbH hela wild type wt cells
    INTS6 is required for efficient DNA damage repair. ( A ) Left: Representative images of the clonogenic assay in control and INTS6 knockdown cells. The cells were stained and counted after 10 days of growing. Right: Quantification of left. * P ≤ 0.05, ** P ≤ 0.01. ( B ) MTT assay to show cell viability (%) at indicated time points in siCtrl and siINTS6 cells with or without 2 Gy IR treatment. Error bar = mean ± SD, significance was determined using unpaired Student’s t -test, * P ≤ 0.05. ( C ) Left: Drawing of DR-GFP HR reporter strategy. Right: Bar chart shows the efficiency of HR repair in DR-GFP <t>HeLa</t> reporter cells, as measured by FACS. BRCA1 knockdown was used as the positive control. ****P ≤ 0.0001, ***P ≤ 0.001. ( D ) Top: Representative images of comet assay in siCtrl, siINTS6, siRAD51 and si53BP1 cells. siRAD51 and si53BP1 cells were used as positive controls. IR = 5 Gy. Error bar = 100 μm. Bottom: Quantification of top. **** P ≤ 0.0001, ** P ≤ 0.01. ( E ) Model: INTS6 as part of tetrameric SOSS1 complex binds to DNA:RNA hybrids at DSBs and recruits PP2A to dephosphorylate RNAPII. Depletion of INTS6 results in increased levels of DARTs and DNA:RNA hybrids. INTS6 interacts with SETX and is required for its recruitment to damaged sites. SETX, in turn, resolves DNA:RNA hybrids at DSBs facilitating their INTS6-dependent autoregulation. Image was created with Biorender.
    Hela Wild Type Wt Cells, supplied by CLS Cell Lines Service GmbH, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hela+wild+type+wt+cells/HeLa+Cells/pm38971996-70-0-7
    Average 95 stars, based on 1 article reviews
    hela wild type wt cells - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    INTS6 is required for efficient DNA damage repair. ( A ) Left: Representative images of the clonogenic assay in control and INTS6 knockdown cells. The cells were stained and counted after 10 days of growing. Right: Quantification of left. * P ≤ 0.05, ** P ≤ 0.01. ( B ) MTT assay to show cell viability (%) at indicated time points in siCtrl and siINTS6 cells with or without 2 Gy IR treatment. Error bar = mean ± SD, significance was determined using unpaired Student’s t -test, * P ≤ 0.05. ( C ) Left: Drawing of DR-GFP HR reporter strategy. Right: Bar chart shows the efficiency of HR repair in DR-GFP HeLa reporter cells, as measured by FACS. BRCA1 knockdown was used as the positive control. ****P ≤ 0.0001, ***P ≤ 0.001. ( D ) Top: Representative images of comet assay in siCtrl, siINTS6, siRAD51 and si53BP1 cells. siRAD51 and si53BP1 cells were used as positive controls. IR = 5 Gy. Error bar = 100 μm. Bottom: Quantification of top. **** P ≤ 0.0001, ** P ≤ 0.01. ( E ) Model: INTS6 as part of tetrameric SOSS1 complex binds to DNA:RNA hybrids at DSBs and recruits PP2A to dephosphorylate RNAPII. Depletion of INTS6 results in increased levels of DARTs and DNA:RNA hybrids. INTS6 interacts with SETX and is required for its recruitment to damaged sites. SETX, in turn, resolves DNA:RNA hybrids at DSBs facilitating their INTS6-dependent autoregulation. Image was created with Biorender.

    Journal: Nucleic Acids Research

    Article Title: Tetrameric INTS6-SOSS1 complex facilitates DNA:RNA hybrid autoregulation at double-strand breaks

    doi: 10.1093/nar/gkae937

    Figure Lengend Snippet: INTS6 is required for efficient DNA damage repair. ( A ) Left: Representative images of the clonogenic assay in control and INTS6 knockdown cells. The cells were stained and counted after 10 days of growing. Right: Quantification of left. * P ≤ 0.05, ** P ≤ 0.01. ( B ) MTT assay to show cell viability (%) at indicated time points in siCtrl and siINTS6 cells with or without 2 Gy IR treatment. Error bar = mean ± SD, significance was determined using unpaired Student’s t -test, * P ≤ 0.05. ( C ) Left: Drawing of DR-GFP HR reporter strategy. Right: Bar chart shows the efficiency of HR repair in DR-GFP HeLa reporter cells, as measured by FACS. BRCA1 knockdown was used as the positive control. ****P ≤ 0.0001, ***P ≤ 0.001. ( D ) Top: Representative images of comet assay in siCtrl, siINTS6, siRAD51 and si53BP1 cells. siRAD51 and si53BP1 cells were used as positive controls. IR = 5 Gy. Error bar = 100 μm. Bottom: Quantification of top. **** P ≤ 0.0001, ** P ≤ 0.01. ( E ) Model: INTS6 as part of tetrameric SOSS1 complex binds to DNA:RNA hybrids at DSBs and recruits PP2A to dephosphorylate RNAPII. Depletion of INTS6 results in increased levels of DARTs and DNA:RNA hybrids. INTS6 interacts with SETX and is required for its recruitment to damaged sites. SETX, in turn, resolves DNA:RNA hybrids at DSBs facilitating their INTS6-dependent autoregulation. Image was created with Biorender.

    Article Snippet: HeLa wild-type (WT) cells were obtained from ATCC.

    Techniques: Clonogenic Assay, Control, Knockdown, Staining, MTT Assay, Positive Control, Single Cell Gel Electrophoresis